Analysis of BRCA1 gene exon 2 mutation in breast cancer patients in a South Indian population

 

Andrea Mary Francis, Ramya. R, Nalini Ganesan, Kumarasamy P,  Solomon F. D Paul, Munirajan A. K, Roobini. J

 

ABSTRACT:

Hormone related cancer breast cancer has been caused by defects in cell cycle control genes BRCA1 and BRCA2 which also plays a vital role in tumour suppression and DNA repair. To determine the frequency of occurrence of 185delAG mutation of BRCA1 in exon 2 regions which has been previously reported in Ashkenazi Jewish families and also in Indian population. 200 breast cancer affected and 200 healthy age matched control samples were screened for 185delAG mutation by taqman allelic discrimination assay. Among the 200 breast cancer affected cases 29 had family history of cancer and 5 out of the 29 family history group had classic history of multiple members being affected across generations. The study demonstrates though in low frequency the definite strong involvement of 185delAG mutation in familial cases and absence of this mutation in non familial cases. The association of the mutation with breast cancer patients imposes genetic testing in familial cases, making way for targeted therapy and precision medicine. The identification of this mutation as a causal factor for breast cancer will be of value to researchers, patient care, clinicians, for family members and individuals with early onset of cancer.

 

 

 

INTRODUCTION:

World wide breast cancer is the most common cancer in gynecological malignancies among women. It is expected that by 2030 there will be rise in the number of breast cancer cases diagnosed every year to be over 2 million, there by increasing the burden of breast cancer globally¹. In India, Breast cancer holds second position among the cancer of females^2,3. Breast cancer incidence (age standardized) globally is 43.3 per 100,000 and the incidence is about 25.8 per 100,000 in India⁴. About 5-10% of the breast cancer is accounted by early onset of breast cancer and familial genetic predisposition to breast cancer cases⁵. With respect to the familial cases of breast cancer it is linked to the mutations in two genes namely BRCA1 and BRCA2 which are autosomal dominant.

 

 

The gene BRCA1 encodes nuclear protein of 1863 amino acids. Studies conducted previously have shown the implication of BRCA1 in the regulated control of expression of genes at the level of transcription^6,7. Cancer trigger is caused by susceptibility genes in several modes one way is that the germ line mutations in DNA repair genes and tumour suppressor genes lead to accumulation of mutations in oncogenes and cell cycle check point genes and ultimately resulting in uncontrolled cell growth. A number of link have been evolved between the germline mutation of BRCA1 and DNA damage respone pathways⁸.

 

The BRCA1 gene, located at 17q21, and BRCA2, at 13q12, have long coding sequences(5589) and 10254 respectively and it is crucial for mending double strand breaks by the homologous recombination repair  pathway^9,10,11. About 3500 mutations that are deleterious is found on the coding regions of the BRCA¹². Carriers of BRCA1 and BRCA2 are at high chance of developing cancers of the pancreas, endometrium, prostate and fallopian tubes^13,14,15. The carriers are also at increased life time risk of ovarian and breast cancer^16,17. Due to the cost involved in the genetic analysis BRCA1 and BRCA2 testing has been restricted to patients with high risk. The high risk group includes early onset of the disease determined by the young age at the time of diagnosis, a family history of ovarian or breast cancer, triple negative breast cancer^18,19,20. For BRCA mutation patients the clinical practice followed is prophylactic surgery, chemoprevention and screening for ovarian and breast cancer²¹. The practice is extended to the family so that other members who may be at risk of developing breast cancer may be identified and appropriate counseling and advise may be provided²². In developing countries owing to the high cost and limited infrastructure. BRCA1 and BRCA2 genetic testing is not available. The other drawback is that the BRCA1 has long coding sequences and there is no particular mutation hotspot regions. The founder mutation screening methods are useful means of testing followed in genetic testing for certain populations. About 11 such mutation is identified in population of polish, Ashkenazi Jews, and French Canadians, Iceland, polish^23,24. Such population specific mutation is not yet established for India. Thus testing the genetic status could probably offer management option for BRCA1 mutation carriers.

 

STUDY SUBJECTS:

The present study consist of 200 histological confirmed breast cancer patients from South India. The patients were from the department oncology of Sri Ramachandra Medical College and Research Institute, Chennai. Relevant clinical and pathological data were gathered from all the patients. Pathological grading of the tumors were obtained by the histopathological examination. The inclusion criteria for the healthy volunteers were: no previous diagnosis of any benign breast diseases; no history of mastectomy, oophorectomy or hysterectomy; no family history of ovarian, breast, endometrial and prostate cancer, no mental or physical disability. The patients and controls were similar in ethnicity and nutritional habits and they were age matched. The criteria for breast cancer patients were no previous treatment for cancer and confirmation of breast malignancy with histological diagnosis. Informed consent was mandatory for both groups. Ethical clearance has been obtained from the institutional ethical committee of Sri Ramachandra Medical College and Research Institute for control and breast cancer affected groups. informed consent was obtained in written and collected from all the subjects enrolled for the study. The study consist 0f 171 non familial sporadic breast cancer cases and 29 familial cases among the familial cases 5 were of classic history of having multiple members being affected (Figure:1)

 

Figure1 Distribution breast cancer cases in familial, Non familial and multiple family members affected

 

Materials and Methods: Molecular analysis by Taqman allelic discrimination assay:

Peripheral blood lymphocyte samples about 3ml was obtained by veinpuncture and collected into K2 - EDTA vacutainers. DNA isolated from peripheral blood samples using salting-out method. DNA sample analyzed for the selected mutation by Taqman methodology with real-time polymerase chain reaction technology (Taqman SNP Genotyping Assay, life technologies Applied Biosystems, Carlsbad, USA). The DNA isolated was amplified using Taq Gold Polymerase of Taqman PCR master mix in ABI machine Quant studio flex 7.0 real time PCR machine.using sequence specific primers. The reaction volume was set to 5 μL, consisting of 2.50 μL of (2X) Taqman genotyping master mix, 0.25 μL of (20X) Taqman mutation assay mix and 2.25 μL of the genomic DNA of 10 ng concentration obtained on diluting the DNA with distilled water. Thermal cycle reaction condition is programmed to initial denaturation temperature and timing set at 95◦C for 10 minutes followed by further denaturation at temperature set at 95◦C for 15s for 40 cycles followed by annealing and extension temperature and timing set at 60 C for 1 minute in 384 wells in ABI Quant studio flex 7.0 real time PCR machine. Fluorescent signals are obtained for the amplification of each allele by the taqman probes (Figure 2). After the amplification by PCR, an end plate read will be performed in ABI machine. The fluorescent measurement taken during the plate read will be used by the sequence detection system and fluorescence the (Rn) values are plotted with the signals obtained from each well. Alleles as to which alleles are present in each sample is indicated by the fluorescence signal. Each fluorescent detector will be a perfect match for the allele 1 (wild type) and the other for allele 2 (mutant). The VIC and FAM dye are used for labeling the dyes. (Table1).

 

Table 1: Primer Sequences for Taqman allelic discrimination assay

rsID	Primer Sequence
rs80357713	TCATTAATGCTATGCAGAAAATCTT[-/A/AG]AGTGTCCCATCTGGTAAGTCAGCAC

 

Figure 2: Amplification plot of BRCA1 exon 2 for the detection of 185delAG mutation by Taqman allelic discrimination plot

 

DISCUSSION:

BRCA1 185delAG mutation was detected in 1/200 patients screened with a frequency estimated to be 0.5%. With familial cases 1/29 it is (3.4%) with classic history of breast cancer where multiple members are affected across the generation it is 1/5 (20%) (Figure 3). The study demonstrates though in low frequency the definite strong involvement of 185delAG mutation in familial cases and absence of this mutation in non familial cases. The association of the mutation with breast cancer patients imposes genetic testing in familial cases, paving way for targeted therapy and precision medicine Figure 4 shows the pedigree of 4 interesting cases which had classic history of several family members being affected across generation. The sample which was positive for 185delAG mutation have strong familial inheritance of cancer wherein the family 2 under investigation revealed the presence of this deleterious frame shift mutation from the pedigree it was observed that several family members across multiple generations were affected with cancer have lost their life, leaving their children in death fear. The mutation was detected in a patient of 54 years age with aggressive tumour with lung metastasis the patient sister was affected with breast cancer and the brother was affected with liver cancer. They spent all the money for increasing the life span of the loved family members but failed or missed to get the DNA sequenced which could have given them answers. Among carriers of BRCA1 mutation 65% develop the cancer of the breast while about 32% may give rise to ovarian cancer development²⁵. The characterization of BRCA1 mutation spectrum for different population revealed variation in the contribution of mutations in these genes to inherited cancer among populations. There are population specific founder mutation established for Jews (BRCA1 5382insC, 185delAG and BRCa2 6174delT)²⁶. Only few studies are available on the contribution of BRCA1 mutation to breast cancer in the population of India.^{27,28,29,30,31}. The investigation not only paid attention on determining the frequency of BRCA1 185delAG mutation but also on accessing the relation of 185delAG mutation with metastasis demographic characters, family history in a South Indian population. BRCA1 genetic testing is not carried routinely in laboratories for all breast cancer patients the testing is limited to familial history due to high cost involved in analysis, limited infrastructure laborious time consuming methodology and also the complexity involved in the huge exonic region of BRCA1 and BRCA2 and lack of established mutational hotspots or population specific founder mutation for India thus making it difficult to be practiced routinely. The life time risk for breast cancer varies based on the ethnicities and population to as high as 80% and 50% for BRCA2 and BRCA1 mutation carriers^.32,33 . BRCA genetic testing is of significance in terms of prevention for family members and also it may direct novel targeted therapy for the affected individuals with the use of PARP inhibitors^34,35,36.Studies conducted in India previously in different states found the frequency of this 185delAG mutation to be around 0.5% to 4.1%.^{37,38, 31}. A similar result was also reported in two South Indian families by Rajkumar et al. in 2015. One of the study based on the analysis of haplotypes suggested that the 185delAG mutation would have originated independently to Ashkenazi Jews³⁹. The fact that the occurrence of mutation in coastal regions hint that it may be the Ashkenazi Jews mutation would be due to people migration through sea routes. The mutation 185delAG has been reported in all populations studied in India^40,28,30,31. The 185delAG mutation was detected in a family residing in Trivandrum near to Jews settlement area⁴⁰. This mutation was also found in two families from South India from Kerala state³⁰ and also detected in two sisters from a population of multi ethnicity Goa³¹. This frame shift mutation was also found in North India in a Hindu family with no influence of Jewish ancestry.

 

Figure 3: Analysis of the frequency of the BRCA1 185delAG mutation in a South Indian population. DNA from 200 breast cancer subjects were analyzed by TaqMan genotyping. The Scatter diagram shows the end-point fluorescence detection from one 384-well plate using probes and primers detecting BRCA1 185delAG mutation. Taqman allelic discrimination assay allele1 (Presence of deletion)- labelled with VIC (green) and allele 2(Absence of deletion)- labelled with FAM (blue)

 

 

Figure: 4 Pedigree analysis of four interesting familial breast cancer cases with classical history of multiple members affected with cancer across multiple generations. The Family 2 proband was affected with breast cancer and was found to be the carry 185delAG mutation

 

CONCLUSION:

The detection of BRCA1 mutations in breast cancer patients direct treatment modalities, survival and the existence of the mutation may help the family members for monitoring and early detection. Genetic testing on wide group of people irrespective of familial occurrence of breast cancer the frequency was found to be 0.5%. But on taking account of familial cases the frequency increased to about 3%. The result suggests the involvement of the mutation in familial breast cancer cases detection will benefit the treatment option and family members. BRCA1 does play a role in the development of familial breast cancer in Indian women. The fact that only 0.5% had mutations in BRCA1 suggests that other genes may also probably play a role in breast cancer in non familial breast cancer cases.

 

REFERENCES:

1.    Gupta A, Shridhar K, Dhillon PK. A review of breast cancer awareness among women in India: Cancer literate or awareness deficit. Eur J Cancer. 2015; 51:2058–2066.

2.     Gajalakshmi CK SV, Swaminathan R, et al. A population-based survival study on female breast cancer in madras, india. Br J Cancer. 1997; 75:771-775.

3.     P.H Pestonjamasp and Mittra I. Analysis of brca1 involvement in breast cancer in indian women.  J Biosci 2000; 25:19-23.

4.     Varughese A A.  Descriptive study on selected risk factors and histopathology of breast carcinoma in a tertiary care centre in kerala, india with special reference to women under 40 years old. Asian Pac Cancer P. 2015; 16:181-184.

5.     Meindl A DN, Kast K, Rhiem K, Schmutzler R . Hereditary breast and ovarian cancer: New genes, new treatments, new concepts. Disch Arztebl International 2011; 108:323-30.

6.     Alvaro N.A Monteiro,Avery August and Hidesaburo Hanafusa. Evidence of a transcriptional activation function of BRCA1 c-terminal region. Proc Natl Acad Sci .  1996; 93:13595-13599.

7.     Thomas JE SM, Tonkinson JL, et al. Induction of phosphorylation of BRCA1 during the cell cycle and after DNA damage. Cell Growth Differ. 1997; 8:801-809.

8.     Scully R CJ, Ochs RL, et al.  Dynamic changes of brca1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell: 1997; 90: 425-435.

9.     Narod SA Foulkes WD. BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 2004; 4: 665-76.

10.  Miki Y SJ, Shattuck-Eidens D, et al:  A strong candidate for  the breast and ovarian cancer susceptibility gene, brca1. Science 1994; 266:66-71.

11.  Wooster R BG, Lancaster J, et al. Identification of a breast  cancer gene, BRCA2. Nature 1995,378: (6559):789-92.

12.  Petrucelli N DM, Feldman GL  Hereditary breast and ovarian cancer due to mutations in BRCA1 and BRCA2 . Genetics in Medicine.2010; 12:245–259.

13.  Medeiros F MM, Lee Y, Elvin JA, Callahan MJ, et al. The tubal fimbria is a preferred site for early adenocarcinoma in women with familial ovarian cancer syndrome.  Am J Surg Pathol  (2006); 30:230–236.

14.  Lynch HT DC, Snyder CL, Lynch JF, Villeneuve P, et al. Brca1 and pancreatic cancer: Pedigree findings and their causal relationships. Cancer Genet Cytogenet.2004; 158:119–125.

15.  Edwards SM K-JZ, Meitz J, Hamoudi R, Hope Q, et al. Two percent of men with early-onset prostate cancer harbor germline mutations in the BRCA2 gene. Am J Hum Genet. 2003; 72:1–12.

16.  Antoniou A PP, Narod S, Risch HA, Eyfjord JE, Hopper JL, et al.  Average risks of breast and ovarian cancer associated with BRCA1 or BRCA2 mutations detected in case series unselected for family history: A combined analysis of 22 studies. Am J Hum Genet. 2003; 72:1117–30.

17.  King MC MJ, Mandell JB, New york breast cancer study group. Breast and ovarian cancer risks due to inherited mutations in BRCA1 and BRCA2. Science. 2003; 302:643-6.

18.  Fostira F TM, Papadimitriou C, Pertesi M, Timotheadou E, Stavropoulou AV, et al. Prevalence of BRCA1 mutations among 403 women with triple-negative breast cancer: Implications for genetic screening selection criteria: A hellenic cooperative oncology group study. Breast Cancer Res Treat. 2012;11:2021-9.

19.  Wong-Brown MW MC, Carpenter JE, Clarke CL, Narod SA, Jakubowska A, et al.  Prevalence of BRCA1 and BRCA2 germline mutations in patients with triple-negative breast cancer. Breast Cancer Res Treat. 2015; 15:393-7.

20.  Pal T BD, Cragun D, Johnson S, Akbari M, Servais L, et al. BRCA sequencing and large rearrangement testing in young black women with breast cancer. J Community Genet. 2014; 13:0166-9.

21.  Paradiso A FS. Hereditary breast cancer: Clinical features and risk reduction strategies. Annals of Oncology. 2011; 22:31-36.

22.  Clark AS DS. Clinical management of hereditary breast cancer syndromes. J Mammary Gland Biol Neoplasia 2011; 16(1):17-25.

23.  Tulinius H OG, Sigvaldason H, et al. The effect of a single BRCA2 mutation on cancer in iceland. J Med Genet. 2002; 39:457-462.

24.  Gorski B BT, Huzarski T, et al. Founder mutations in the BRCA1 gene in polish families with breast-ovarian cancer. Am J Hum Genet. 2000; 66:1963-1968.

25.  Antoniou A PP, Narod S, Risch HA, Eyfjord JE, et al. Average risks of breast and ovarian cancer associated with BRCA1 or BRCA2 mutations detected in case series unselected for family history: A combined analysis of 22 studies. Am J Hum Genet. 2003; 72:1117-1130.

26.  Szabo CI KM. Population genetics of BRCA1 and BRCA2. Am J Hum Genet. 1997; 60:1013-1020.

27.  Kumar BV LS, Ankathil R, Madhavan J, Jayaprakash PG, et al.  Germline BRCA1 mutation analysis in Indian breast/ovarian cancer families. Cancer BiolTher. 2002: 1:18-21.

28.  Saxena S SC, Chopin S, Barjhoux L, Sinilnikova O, et al. BRCA1 and BRCA2 in Indian breast cancer patients. Hum Mutat. 2002: 20:473-474.

29.  Valarmathi MT AA, Deo SS, Shukla NK, Das SN . BRCA1 germline mutations in Indian familial breast cancer. Hum Mutat.2003; 21:98-99.

30.  Valarmathi MT SM, Deo SS, Shukla NK, Das SN . Novel germline mutations in the BRCA1 and BRCA2 genes in Indian breast and breast-ovarian cancer families. Hum Mutat.2004; 23: 205.

31.  Hedau S JN, Husain SA, Mandal AK, Ray G, et al. Novel germline mutations in breast cancer susceptibility genes BRCA1, BRCA2 and p53 gene in breast cancer patients from India. Breast Cancer Res Treat. (2004); 88:177-186.

32.  Easton DF FD, Bishop DT. Breast and ovarian cancer incidence in BRCA1-mutation carriers. Breast cancer linkage consortium. Am J Hum Genet.1995; 56:  265–271.

33.  Chen S PG. Meta-analysis of BRCA1 and BRCA2 penetrance. Journal of Clinical Oncology. 2006; 25:1329–1333.

34.  Kwon JS DM, Sun CC, Lu KH  Preventing future cancers by testing women with ovarian cancer for BRCA mutations. Journal of Clinical Oncology 2010; 28:675-682.

35.  Trainer AH LC, Tucker K, Meiser B, Friedlander M, et al. The role of BRCA mutation testing in determining breast cancer therapy. Nature Publishing Group.2010; 7:708–717.

36.  Tutt A RM, Garber JE, Domchek SM, Audeh MW, et al. Oral poly (adp-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: A proof-of-concept trial. Lancet. 2010; 376:235–244.

37.  Rajkumar T MB, Mani S, et al. Targeted resequencing of 30 genes improves the detection of deleterious mutations in south Indian women with breast and/or ovarian cancers. Asian Pac J Cancer P. 2015;16:5211– 5217.

38.  Hansa J KRaGS. Screening of 185delAG, 1014delGT and 3889delAG BRCA1 mutations in breast cancer patients from north-east india. Asian Pac J Cancer P. 2012; 13:5871–5874.

39.  Kadalmani K DS, Bagavathi S, et al. Neoplasma : Independent origin of 185delAG BRCA1 mutation in an Indian family. 2007; 54:51–56.

40.  Kumar BV LS, Ankathil R, Madhavan J, Jayaprakash PG, et al.  Germline brca1 mutation analysis in Indian breast/ovarian cancer families. Cancer Biol Ther. 2002; 1:18-21.

 

 

Accepted on 20.08.2018        © RJPT All right reserved

Research J. Pharm. and Tech 2018; 11(10): 4592-4596.